Practice writing custom functions
Practice iterations using for loops and map
functions
map functions
to automate repetitive tasksgithub_document, save it in your
lab folder as lab9.Rmd, and work in this
RMarkdown file for the rest of this lab. Load the following
package.library(tidyverse)
dna_or_rna(sequence), that
determines if a sequence of base pairs is DNA, RNA, or if it is not
possible to tell given the sequence provided.Since all the function will know about the material is the
sequence, the only way to tell the difference between DNA and RNA is
that RNA has the base Uracil ("u") instead of the base
Thymine ("t").
Have the function return one of three outputs: “DNA”, “RNA”, or “unknown”. Then run the following three lines of code:
dna_or_rna("attggc")
dna_or_rna("gccaau")
dna_or_rna("ccagac")
dna_or_rna("tgcacug")
Hint: the str_split function might be helpful.
dna_or_rna("attggc")
## [1] "DNA"
dna_or_rna("gccaau")
## [1] "RNA"
dna_or_rna("ccagac")
## [1] "unknown"
dna_or_rna("tgcacug")
## [1] "unknown"
dna_or_rna
## function (sequence)
## {
## bases <- str_split(sequence, pattern = "") %>% unlist() %>%
## unique()
## if (all(bases %in% c("a", "t", "g", "c")) & "t" %in% bases) {
## return("DNA")
## }
## else if (all(bases %in% c("a", "u", "g", "c")) & "u" %in%
## bases) {
## return("RNA")
## }
## else {
## return("unknown")
## }
## }
## <bytecode: 0xc3514f850>
dna_or_rna() function and a for loop to
print the type of the sequences in the following list.sequences = c("ttgaatgccttacaactgatcattacacaggcggcatgaagcaaaaatatactgtgaaccaatgcaggcg",
"gauuauuccccacaaagggagugggauuaggagcugcaucauuuacaagagcagaauguuucaaaugcau",
"gaaagcaagaaaaggcaggcgaggaagggaagaagggggggaaacc",
"guuuccuacaguauuugaugagaaugagaguuuacuccuggaagauaauauuagaauguuuacaacugcaccugaucagguggauaaggaagaugaagacu",
"gataaggaagaugaagacutucaggaaucuaauaaaaugcacuccaugaauggauucauguaugggaaucagccggguc")
sequence_type <- vector("double", length(sequences))
for (i in seq_along(sequences)){
sequence_type[i] <- dna_or_rna(sequences[i])
}
sequence_type
## [1] "DNA" "RNA" "unknown" "RNA" "unknown"
dna_or_rna() function and an appropriate
map function to print the type of the sequences in the above list.map_chr(sequences, dna_or_rna)
## [1] "DNA" "RNA" "unknown" "RNA" "unknown"
## Alternatively
map(sequences, dna_or_rna) %>% unlist()
## [1] "DNA" "RNA" "unknown" "RNA" "unknown"
dna_or_rna("ATTGGC")
dna_or_rna("gCCAAu")
dna_or_rna("ggcacgG")
dna_or_rna("ATTGGC")
## [1] "DNA"
dna_or_rna("gCCAAu")
## [1] "RNA"
dna_or_rna("ggcacgG")
## [1] "unknown"
dna_or_rna
## function (sequence)
## {
## bases <- str_split(sequence, pattern = "") %>% unlist() %>%
## tolower() %>% unique()
## if (all(bases %in% c("a", "t", "g", "c")) & "t" %in% bases) {
## return("DNA")
## }
## else if (all(bases %in% c("a", "u", "g", "c")) & "u" %in%
## bases) {
## return("RNA")
## }
## else {
## return("unknown")
## }
## }
## <bytecode: 0xc37d85070>
Share your findings, challenges, and questions with the class.
![]()
Rounding appears to be a very simple arithmetic operation. However, things get a little bit complicated when it comes to the number 5, which is at the exact mid-point between rounding up and rounding down.
The round function in base R is weird. It is supposed to
use a round half to even rule when rounding off a
5 (see https://en.wikipedia.org/wiki/Rounding#Round_half_to_even).
However, this is dependent on your computer’s operating system, and
therefore this rule is sometimes inconsistent. For example:
# This is how a "round half to even" rule should work
round(0.5, digits=0)
## [1] 0
round(1.5, digits=0)
## [1] 2
round(-0.5, digits=0)
## [1] 0
round(-1.5, digits=0)
## [1] -2
# Things get weird sometimes though
round(0.55, digits=1) # This is what we would expect
## [1] 0.6
round(2.45, digits=1) # Under a "round half to even" rule, we are expecting it to reture 2.4. However, here it returns 2.5 on my operating system (might be different for yours)
## [1] 2.5
Hint: you may need the arithmetic operator
%/% and the sign() function.
The following is how it should work:
#Example output
round_away(0.55, digits=0)
## [1] 1
round_away(2.45, digits=0)
## [1] 2
round_away(-0.55, digits=0)
## [1] -1
round_away(-2.45, digits=0)
## [1] -2
round_away(0.55, digits=1)
## [1] 0.6
round_away(2.45, digits=1)
## [1] 2.5
round_away(-0.55, digits=1)
## [1] -0.6
round_away(-2.45, digits=1)
## [1] -2.5
round_away
## function (x, digits = 0)
## {
## x_new <- abs(x * 10^digits)
## x_sign <- sign(x)
## integer <- x_new%/%1
## decimal <- x_new - integer
## if (decimal < 0.5) {
## x_new <- integer
## }
## else {
## x_new <- integer + 1
## }
## x_rounded <- x_new/10^digits * x_sign
## return(x_rounded)
## }
## <bytecode: 0xc38ed89e0>
Hint: you will need the arithmetic operator
%%.
The following is how this function should work:
#Example output
round_even(0.55, digits=0)
## [1] 1
round_even(2.45, digits=0)
## [1] 2
round_even(-0.55, digits=0)
## [1] -1
round_even(-2.45, digits=0)
## [1] -2
round_even(0.55, digits=1)
## [1] 0.6
round_even(2.45, digits=1)
## [1] 2.4
round_even(-0.55, digits=1)
## [1] -0.6
round_even(-2.45, digits=1)
## [1] -2.4
round_even
## function (x, digits = 0)
## {
## x_new <- abs(x * 10^digits)
## x_sign <- sign(x)
## integer <- x_new%/%1
## decimal <- x_new - integer
## if (decimal < 0.5) {
## x_new <- integer
## }
## else if (decimal == 0.5) {
## if (integer%%2 == 0) {
## x_new <- integer
## }
## else {
## x_new <- integer + 1
## }
## }
## else {
## x_new <- integer + 1
## }
## x_rounded <- x_new/10^digits * x_sign
## return(x_rounded)
## }
## <bytecode: 0xc39edc938>
Share your findings, challenges, and questions with the class.
END LAB 9